Prev. | 

RIKEN DNA Bank Human Resource - CRNDE

Gene ID NCBI Gene 643911 |  KEGG hsa:643911
Gene Symbol CRNDE
Protein Name colorectal neoplasia differentially expressed
Synonyms CRNDEP|LINC00180|NCRNA00180|PNAS-108|lincIRX5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235543 ARiS088O07 pGCAP10 NR_034105.1 done
GCCGCCGCAGCCGCAGCCCCTGGCGCTAACGGTCGGTAACGGCCCGCGCGCGCCGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl