Prev. | 

RIKEN DNA Bank Human Resource - ZNF876P

Gene ID NCBI Gene 642280 |  KEGG hsa:642280
Gene Symbol ZNF876P
Protein Name zinc finger protein 876, pseudogene
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326574 RBb16H06 pKA1U5 XR_041103.1  
GATCCGGGATCTGGCGCCGCTTTTGCGTCAGGCTTCTGCCTGAGCTCGGTTAGGGCCTCA
HKR369626 RBd24B02 pGCAP10 XR_041103.1  
GGCTGCCGCTGGAGCTCCAGATCTCTTGTTCACTGCTCTGTGTTCTCTGCTCATAGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl