Prev. | 

RIKEN DNA Bank Human Resource - SEPTIN7P2

Gene ID NCBI Gene 641977 |  KEGG hsa:641977
Gene Symbol SEPTIN7P2
Protein Name septin 7 pseudogene 2
Synonyms SEPT13|SEPT7B|SEPT7P2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066851 ARe67C03 pKA1U5 NR_024271.1  
GGCTGGCTACGGGTGGCCGGGCGGGATGTAACCGGCTGCTGAGCTGGCAGTTCTGTGTCC
HKR428278 RBdS070L14 pGCAP10 NR_024271.1  
GTCTTCCAGGAGCGCGCATGAGCGGACGCTGCCTACGGGTGGCCGGGCGGGATGTAACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl