Prev. |  KEGG KO K00326 > 

RIKEN DNA Bank Human Resource - CYB5RL

Gene ID NCBI Gene 606495 |  KEGG hsa:606495
Gene Symbol CYB5RL
Protein Name cytochrome b5 reductase like
Synonyms -
Ortholog resource in our bank

  CYB5RL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037202 IRAK093A02 pCMV-SPORT6 BC049198 NM_001031672 Partial
HGX055896 IRAK139M08 pCMV-SPORT6 BC064419 NM_001031672 Full
HGX066492 IRAK166D20 pCMV-SPORT6 BC071735 NM_001031672 Full
HGY090150 IRAL025G06 pOTB7 BC012781 NM_001031672 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR396574 RBd91H06 pGCAP10 NM_001031672.2  
GAAAATCCTCACGTGAGGTGAAGCGCAGGCGAGTAGGGCCAGACATGGTGGCTCATGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl