Prev. |  KEGG KO K11254 > 

RIKEN DNA Bank Human Resource - H4C15

Gene ID NCBI Gene 554313 |  KEGG hsa:554313
Gene Symbol H4C15
Protein Name H4 clustered histone 15
Synonyms H4-16|H4/o|H4C1|H4C11|H4C12|H4C13|H4C14|H4C2|H4C3|H4C4|H4C5|H4C6|H4C8|H4C9|HIST2H4B
Ortholog resource in our bank

  H4C15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR383635 RBd59B11 pGCAP10 NM_001034077.4 done
GAGAAGCTGTCTATCGGGCTCCAGCGGTCATGTCCGGCAGAGGAAAGGGCGGAAAAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl