Prev. | 

RIKEN DNA Bank Human Resource - ATXN7L3B

Gene ID NCBI Gene 552889 |  KEGG hsa:552889
Gene Symbol ATXN7L3B
Protein Name ataxin 7 like 3B
Synonyms lnc-SCA7
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007783 IRAK019H15 pCMV-SPORT6 BC009111

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR390808 RBd77A08 pGCAP10 NR_015371.1  
GGAGGCGGGGCTAGGCCCGACAGGGGAGCGGAAGAGGCCCAGGAGGCTGGGTGAGGCGCT
HKR393348 RBd83G04 pGCAP10 NR_015371.1  
GGAGACGGTTTGGCGGTGAGTCCTGGGCCAGGCGCAGCTGAAAGGCCCGCAACCCGGGAA
HKR396059 RBd90C11 pGCAP10 NR_015371.1  
GAGGGGAGCGGAAGAGGCCCAGGAGGCTGGGTGAGGCGCTGAGACGGTTTGGCGGTGAGT
HKR461605 RBdS154A05 pGCAP10 NR_015371.1  
GGGGTGAGGCGCTGAGACGGTTTGGCGGTGAGTCCTGGGCCAGGCGCAGCTGAAAGGCCC
HKR461970 RBdS154P10 pGCAP10 NR_015371.1  
GGGGTGAGGCGCTGAGACGGTTTGGCGGTGAGTCCTGGGCCAGGCGCAGCTGAAAGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl