Prev. | 

RIKEN DNA Bank Human Resource - NBDY

Gene ID NCBI Gene 550643 |  KEGG hsa:550643
Gene Symbol NBDY
Protein Name negative regulator of P-body association
Synonyms LINC01420|NoBody
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY042734 IRAK106N22 pBluescript BC048131
HGY100595 IRAL051I03 pDNR-LIB BC062451

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374403 RBd36A03 pGCAP10 NR_015367.2  
GTCTCTGTGCCTGGAGGGGACTCGCCGCCATCTCAGGTCTCTTGGCTTTGCCAGGGCCCA
HKR395323 RBd88F03 pGCAP10 NR_015367.2  
GGAGGGGACTCGCCGCCATCTCAGGTCTCTTGGCTTTGCCAGGGCCCACCGGAGAAAACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl