Prev. | 

RIKEN DNA Bank Human Resource - DUXAP10

Gene ID NCBI Gene 503639 |  KEGG hsa:503639
Gene Symbol DUXAP10
Protein Name double homeobox A pseudogene 10
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR020033 ARa50B09 pKA1U5 BC017398  
GCTCTACCAGCCTTATTCTTTGAACCTCATGTTCTTCAGGTTTCTTCATGTGGCTGCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl