Prev. | 

RIKEN DNA Bank Human Resource - C18orf32

Gene ID NCBI Gene 497661 |  KEGG hsa:497661
Gene Symbol C18orf32
Protein Name chromosome 18 open reading frame 32
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094493 IRAL036D21 pDNR-LIB BC022357 NM_001035005 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048097 ARe20E01 pKA1U5 NM_001035005.2  
GGAGTGTGCCCGGGCTAGCGGCCTGGGTTGGGCTTTGTTAGCTGCTCCGCAGGCCCAGCC
HKR279430 ARiS198J14 pGCAP10 NM_001035005.2  
GAGTGCGGACATTGTCAGCTGCGTTTCCGCGGTCGCGGTTGAGGAGCTCAAGCTTGGGAA
HKR331653 RBb29C05 pGCAP1 NM_001035005.2  
GCGCGGGTGAGTGTGCCCGGGCTAGCGGCCTGGGTTGGGCTTTGTAGCTGCTCCGCAGGC
HKR373251 RBd33C03 pGCAP10 NM_001035005.2  
GCCCTCCGGAAGTGCGGACATTGTCAGCTGCGTTTCCGCGGTCGCGGTTGAGGAGCTCAA
HKR377772 RBd44H04 pGCAP10 NM_001035005.2  
GGGCCCTCCCTCCGGAAGTGACGAGGTTGTCTTATGCGTTTCCGCGGTGACCGGTGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl