Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BDNF-AS

Gene ID (NCBI) 497258
Gene Symbol BDNF-AS
Protein Name BDNF antisense RNA
Synonyms ANTI-BDNF|BDNF|BDNF-AS1|BDNFAS|BDNFOS|NCRNA00049
Databases KEGG hsa:497258 |  NCBI Gene 497258


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051379 ARe28H11 pKA1U5 NR_002832.1  
GATCGCGAGATCAGGAAGGTGGCCGAGTGTGTCGCCGCGGCCATCAGGCACTTCTCCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl