Prev. | 

RIKEN DNA Bank Human Resource - CHAC2

Gene ID NCBI Gene 494143 |  KEGG hsa:494143
Gene Symbol CHAC2
Protein Name ChaC cation transport regulator homolog 2
Synonyms GCG1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046316 IRAK115N04 pCMV-SPORT6 BC053896 NM_001008708 Full
HGY092733 IRAL031N21 pDNR-LIB BC025376 NM_001008708 Full
HGY092758 IRAL031O22 pDNR-LIB BC019239 NM_001008708 Full
HGY094302 IRAL035M14 pDNR-LIB BC017941 NM_001008708 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR397633 RBd94B09 pGCAP10 NM_001008708.2  
GACTCGCTTACCGGAGGCTTCAGTCCCCGGCGGCGCGGCGACAGCTAGGGTTCACGGCCA
HKR398005 RBd95A05 pGCAP10 NM_001008708.2  
GACTCGCTTACCGGAGGCTTCAGTCCCCGGCGGCGCGGCGACAGCTAGGGTTCACGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl