Prev. | 

RIKEN DNA Bank Human Resource - CISD2

Gene ID NCBI Gene 493856 |  KEGG hsa:493856
Gene Symbol CISD2
Protein Name CDGSH iron sulfur domain 2
Synonyms ERIS|Miner1|NAF-1|WFS2|ZCD2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025669 IRAK064C21 pCMV-SPORT6 BC032300 NM_001008388

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE093632 M01C034B08 pDONR221 MGC06-H04 BC032300 NM_001008388  
HGE093680 M01C034D08 pDONR221 MGC06-H04 BC032300 NM_001008388  
HGE093728 M01C034F08 pDONR221 MGC06-H04 BC032300 NM_001008388  
HGE093776 M01C034H08 pDONR221 MGC06-H04 BC032300 NM_001008388  
HGE093824 M01C034J08 pDONR221 MGC06-H04 BC032300 NM_001008388  
HGE093872 M01C034L08 pDONR221 MGC06-H04 BC032300 NM_001008388  
HGE093920 M01C034N08 pDONR221 MGC06-H04 BC032300 NM_001008388  
HGE093968 M01C034P08 pDONR221 MGC06-H04 BC032300 NM_001008388  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR185275 ARi63D03 pGCAP10 NM_001008388.3  
GGCCCAGGCCGAGGCCGCCAGTGCCCGCCGGCCGCTTCCGCTCCCGGCGCAGGCGCGGCA
HKR420696 RBdS051M08 pGCAP10 NM_001008388.3  
GAGGCGCGGCAGCTTGGCCAGAGCGGAGGGGGCTCGGGAGAGGAGTGGACGCCGCTGGCC
HKR441884 RBdS104L20 pGCAP10 NM_001008388.3  
GGCTTCCGCTCCCGGCGCAGGCGCGGCAGCTTGGCCAGAGCGGAGGGGGCTCGGGAGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl