Prev. | 

RIKEN DNA Bank Human Resource - LRRC24

Gene ID NCBI Gene 441381 |  KEGG hsa:441381
Gene Symbol LRRC24
Protein Name leucine rich repeat containing 24
Synonyms LRRC14OS
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR462615 RBdS156I23 pGCAP10 NM_001024678.4 Full/var done
GACGGCGGGGGAGCCGCTCGCCGCGGGAGCGTCAGGAGGGCACGCGTCTGCGGCTGAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl