Prev. | 

RIKEN DNA Bank Human Resource - LOC441204

Gene ID NCBI Gene 441204 |  KEGG hsa:441204
Gene Symbol LOC441204
Protein Name uncharacterized LOC441204
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY031010 IRAK077I18 pBluescriptR BC039415 XM_943507 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE083233 M01C008B09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  
HGE083281 M01C008D09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  
HGE083329 M01C008F09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  
HGE083377 M01C008H09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  
HGE083425 M01C008J09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  
HGE083473 M01C008L09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  
HGE083521 M01C008N09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  
HGE083569 M01C008P09 pDONR221 FLJ01-G05 AK056484 ENST00000297021  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR321348 RBb03G04 pKA1U5 NR_015364.1  
GCTGCAGCCGGCGGCGGAACGGGGGCAGGCGGCTGANACAGGCGAGCTATTTGCATTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl