Prev. |  KEGG KO K13403 > 

RIKEN DNA Bank Human Resource - MTHFD2L

Gene ID NCBI Gene 441024 |  KEGG hsa:441024
Gene Symbol MTHFD2L
Protein Name methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like
Synonyms -
Ortholog resource in our bank

  MTHFD2L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027259 IRAK068C11 pCMV-SPORT6 BC032771 NM_001004346 Partial
HGY028082 IRAK070D10 pBluescriptR BC037529 NM_001004346
HGY030951 IRAK077G07 pBluescriptR BC041943 NM_001004346

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR462509 RBdS156E13 pGCAP10 NM_001004346.2  
GCCGGAAGCCGGGGATCCGCGGCCATGACGGTGCCGGTCCGCGGCTTCTCGCTGCTCCGC
HKR470985 RBdS177H17 pGCAP10 NM_001004346.2  
GGGAAGCCGGGGATCCGCGGCCATGACGGTGCCGGTCCGCGGCTTCTCGCTGCTCCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl