Prev. | 

RIKEN DNA Bank Human Resource - SMIM4

Gene ID NCBI Gene 440957 |  KEGG hsa:440957
Gene Symbol SMIM4
Protein Name small integral membrane protein 4
Synonyms C3orf78
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094135 IRAL035F15 pDNR-LIB BC017996 XM_941462 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348100 RBb70E04 pGCAP1 NM_001124767.1  
GACTCGTGCGCCTACCAGACAGTGGCGGAGGACGGCGCTCGCTAGTCTCCCAGGTCGCGG
HKR366875 RBd17D03 pGCAP10 NM_001124767.1  
GACAGTGGCGGAGGACGGCGCTCGCTAGTCTCCCAGGTCGCGGTACACGGCGAGAACGGG
HKR368128 RBd20F08 pGCAP10 NM_001124767.1  
GACTCGTGCGCCTACCAGACAGTGGCGGAGGACGGCGCTCGCTAGTCTCCCAGGTCGCGG
HKR433408 RBdS083I16 pGCAP10 NM_001124767.1  
GACTCGTGCGCCTACCAGACAGTGGCGGAGGACGGCGCTCGCTAGTCTCCCAGGTCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl