Prev. | 

RIKEN DNA Bank Human Resource - THUMPD3-AS1

Gene ID NCBI Gene 440944 |  KEGG hsa:440944
Gene Symbol THUMPD3-AS1
Protein Name THUMPD3 antisense RNA 1
Synonyms SETD5-AS1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029522 IRAK073N10 pBluescriptR BC036698 NM_001013713 Partial/var
HGY036261 IRAK090K21 pBluescript BC052961 NM_001013713 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279437 ARiS198J21 pGCAP10 NR_027007.1  
TGCTCAGAGAGCCTCGGCTAGGTGTGGAAACAGGAAGAGAACTAGAACTGGAAGTAAAG
HKR453033 RBdS132J17 pGCAP10 NR_027007.1  
GAGAGAGCCTCGGCTAGGTGTGGAAACAGGAAGAGAACTAGAACTGGAAGTAAAGCATTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl