Prev. | 

RIKEN DNA Bank Human Resource - HCG18

Gene ID NCBI Gene 414777 |  KEGG hsa:414777
Gene Symbol HCG18
Protein Name HLA complex group 18
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR360907 RBd02E11 pGCAP10 NR_024052.1 done
GAGACTTCAAATACTCTTTGTCCTGCCCCTGCTTGGCGAAATTTACCGAAATTATCTACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl