Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GTF2H5

Gene ID (NCBI) 404672
Gene Symbol GTF2H5
Protein Name general transcription factor IIH, polypeptide 5
Synonyms C6orf175|TFB5|TFIIH|TGF2H5|TTD|TTD-A|TTDA|bA120J8.2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX047641 IRAK119B17 pCMV-SPORT6 BC056906 NM_207118 Full
HGX053712 IRAK134E16 pCMV-SPORT6 BC060317 NM_207118
HGY088024 IRAL020A24 pOTB7 BC004568 NM_207118 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE082826 M01C007B02 pDONR221 FLJ01-D01 AK055106 NM_207118
HGE082874 M01C007D02 pDONR221 FLJ01-D01 AK055106 NM_207118
HGE082922 M01C007F02 pDONR221 FLJ01-D01 AK055106 NM_207118
HGE082970 M01C007H02 pDONR221 FLJ01-D01 AK055106 NM_207118
HGE083018 M01C007J02 pDONR221 FLJ01-D01 AK055106 NM_207118
HGE083066 M01C007L02 pDONR221 FLJ01-D01 AK055106 NM_207118
HGE083114 M01C007N02 pDONR221 FLJ01-D01 AK055106 NM_207118
HGE083162 M01C007P02 pDONR221 FLJ01-D01 AK055106 NM_207118

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE038408 W01A096A08 pENTR-TOPO IRAK134E16 BC060317 NM_207118
HGE047478 W01A118L14 pENTR-TOPO IRAK134E16 BC060317 NM_207118
HGE047482 W01A118L18 pENTR-TOPO IRAK134E16 BC060317 NM_207118

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR077628 ARe94B04 pKA1U5 NM_207118.2
GGGCAACGCCGAGGCGCTTCTGCATCTGTGGGCCGAGCATTCTTCAGGTCATCTGAACCT
HKR360975 RBd02H07 pGCAP10 NM_207118.2
GAGGCGCTTCTGCATCTGTGGGCCGAGCATTCTTCAGGTCATCTGAACCTTCTGAGAAAA
HKR365278 RBd13D06 pGCAP10 NM_207118.2
GACTCTGCCGGCAACGCCGAGGCGCTTCTGCATCTGTGGGCCGAGCATTCTTCAGGTCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl