Prev. | 

RIKEN DNA Bank Human Resource - CTXN1

Gene ID NCBI Gene 404217 |  KEGG hsa:404217
Gene Symbol CTXN1
Protein Name cortexin 1
Synonyms CTXN
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085832 IRAL014J16 pOTB7 BC024148 NM_206833 Partial
HGY100534 IRAL051F14 pDNR-LIB BC062702 NM_206833 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048575 ARe21H07 pKA1U5 NM_206833.3  
GCCTCGGTCTCCGCCGCTCCAGGGGCGGGTGNCCGTNANNTGAGCCGGAGCCCGGGCCGC
HKR065684 ARe64D12 pKA1U5 NM_206833.3  
ATCCTGCTAGGCTTGCCTGCCTCGGTCTCCGCCCCNTTANGGGCGGGTGGGGTGGGCTGA
HKR368952 RBd22G08 pGCAP10 NM_206833.3  
TGCTCNTTNGCTCNNGGGGCGGGTGGGGTGGGCTGATCCGGAGCCCTGGCCGCCNCCTCA
HKR374576 RBd36H08 pGCAP10 NM_206833.3  
GCTCCGCCGCTCCAGGGGCGGGTGGGGTGGGCTGAGCCGGAGCCCGGGCCGCCGCCGCCG
HKR420417 RBdS051A17 pGCAP10 NM_206833.3  
CTCGGTCTCCGCCGCTCCAGGGGCGGGTGGGGTGGGCTGAGCCGGAGCCCGGGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl