Prev. | 

RIKEN DNA Bank Human Resource - CUEDC1

Gene ID NCBI Gene 404093 |  KEGG hsa:404093
Gene Symbol CUEDC1
Protein Name CUE domain containing 1
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX047898 IRAK119M10 pCMV-SPORT6 BC056882 NM_017949 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043628 ARe09B04 pKA1U5 NM_017949.1  
GGGGGTCGCCGGGGCCCGTAGTCCTTCTGCGAGGGCGCGAGGACTCCAGGAGCCGTCCTG
HKR057375 ARe43H07 pKA1U5 NM_017949.1  
GCTCCCCCGCCCGGCCCGCGGCCCGGCCCCATGCCNNTTNAGCGGAGCGGACGCGCGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl