Prev. | 

RIKEN DNA Bank Human Resource - SRRD

Gene ID NCBI Gene 402055 |  KEGG hsa:402055
Gene Symbol SRRD
Protein Name SRR1 domain containing
Synonyms HC/HCC|SRR1L
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066906 IRAK167E10 pBluescriptR BC066962 NM_001013694

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE106001 M01C065A01 pDONR221 06_07-A01 BC066962 ENST00000215917  
HGE106049 M01C065C01 pDONR221 06_07-A01 BC066962 ENST00000215917  
HGE106097 M01C065E01 pDONR221 06_07-A01 BC066962 ENST00000215917  
HGE106145 M01C065G01 pDONR221 06_07-A01 BC066962 ENST00000215917  
HGE106193 M01C065I01 pDONR221 06_07-A01 BC066962 ENST00000215917  
HGE106241 M01C065K01 pDONR221 06_07-A01 BC066962 ENST00000215917  
HGE106289 M01C065M01 pDONR221 06_07-A01 BC066962 ENST00000215917  
HGE106337 M01C065O01 pDONR221 06_07-A01 BC066962 ENST00000215917  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044498 ARe11E02 pKA1U5 NM_001013694.2  
GAGGCGGCGGCTCCGCGGAAGAGGCGCTCCGCGGCTCGACGGCCGCGGCGGAGGGAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl