Prev. | 

RIKEN DNA Bank Human Resource - AMTN

Gene ID NCBI Gene 401138 |  KEGG hsa:401138
Gene Symbol AMTN
Protein Name amelotin
Synonyms AI3B|UNQ689
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040451 ARe01C03 pKA1U5 NM_212557.4 full cds done
GAAGGGTAAAATTTTTCACCAGAGTAAACTTGAGAAACCAACTGGACCTTGAGTATTGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl