Prev. | 

RIKEN DNA Bank Human Resource - CHCHD10

Gene ID NCBI Gene 400916 |  KEGG hsa:400916
Gene Symbol CHCHD10
Protein Name coiled-coil-helix-coiled-coil-helix domain containing 10
Synonyms C22orf16|FTDALS2|IMMD|N27C7-4|SMAJ
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046357 IRAK115O21 pCMV-SPORT6 BC053570 NM_213720 Full
HGX055888 IRAK139L24 pCMV-SPORT6 BC065232 NM_213720

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096018 M01C040A18 pDONR221 MGC09-F09 BC065232 NM_213720  
HGE096066 M01C040C18 pDONR221 MGC09-F09 BC065232 NM_213720  
HGE096114 M01C040E18 pDONR221 MGC09-F09 BC065232 NM_213720  
HGE096162 M01C040G18 pDONR221 MGC09-F09 BC065232 NM_213720  
HGE096210 M01C040I18 pDONR221 MGC09-F09 BC065232 NM_213720  
HGE096258 M01C040K18 pDONR221 MGC09-F09 BC065232 NM_213720  
HGE096306 M01C040M18 pDONR221 MGC09-F09 BC065232 NM_213720  
HGE096354 M01C040O18 pDONR221 MGC09-F09 BC065232 NM_213720  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065655 ARe64C07 pKA1U5 NM_213720.1  
GGGCATTTGNTCCCCGCGACAGCACCGCTGCCGCCGTTCTCTAAGGTCGCCCGGGATCCC
HKR324059 RBb10C11 pKA1U5 NM_213720.1  
GGCATTTGGTCCCCGCGTACAGCACCGNCTTGCCGCCGTTCTCATAAGGGTCGCCCGGGN
HKR342554 RBb56G10 pGCAP1 NM_213720.1  
TGGACAAGCGCTGCGGCATTTGTTCCCCGCGACAGCACCGCTTGCCGCCGNTCTCTAAGG
HKR376429 RBd41B05 pGCAP10 NM_213720.1  
GATTTGTCCCCGCGACAGCACCGCTGCCGCCGTCTCTAAGGTCGCCCGGGTCCCACCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl