RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ZNF772

Gene ID	NCBI Gene 400720 \| KEGG hsa:400720
Gene Symbol	ZNF772
Protein Name	zinc finger protein 772
Synonyms	-

Ortholog resource in our bank

  ZNF772

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR166484	ARi16D12	pGCAP10	NM_001024596.1
HKR166484	GATTAATCCACTGGTTTAGTTTCCAGAACGCAATGTCAGACCTGAGGTGACAGAAAAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl