Prev. |  KEGG KO K17930 > 

RIKEN DNA Bank Human Resource - SNX19

Gene ID NCBI Gene 399979 |  KEGG hsa:399979
Gene Symbol SNX19
Protein Name sorting nexin 19
Synonyms CHET8
Ortholog resource in our bank

  SNX19

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247316 ARiS118E20 pGCAP10 NM_014758.2  
GGTCGCCGGCGGCCGGCCGGCGGTCAGCCTTCACACAGGCCCGGCTGCGGAGCGCAGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl