Prev. | 

RIKEN DNA Bank Human Resource - PCNX3

Gene ID NCBI Gene 399909 |  KEGG hsa:399909
Gene Symbol PCNX3
Protein Name pecanex 3
Synonyms PCNXL3
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276451 ARiS191C03 pGCAP10 NM_032223.2  
GGGCCTCCTCCTTAGGCCGGCACCAGCAGAAGCCGGGCGAGCGCGGAGCCCCAAGCAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl