Prev. | 

RIKEN DNA Bank Human Resource - PTRHD1

Gene ID NCBI Gene 391356 |  KEGG hsa:391356
Gene Symbol PTRHD1
Protein Name peptidyl-tRNA hydrolase domain containing 1
Synonyms C2orf79
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103310 IRAL058E14 pOTB7 BC073803 NM_001013663

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080425 ARf01B01 pKA1U5 NM_001013663.1  
GGGTCAGGAAGATGGCGGCCTCTGGGGCGGAGCCGCAGGTCCTGGTACAATACTTGGTGT
HKR362879 RBd07D07 pGCAP10 NM_001013663.1  
AGGTCCGGCCTTTCGGGTGGTCAGGAAGATGGCGGCCTCTGGGGCGGAGCCGCAGGTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl