Prev. | 

RIKEN DNA Bank Human Resource - IER5L

Gene ID NCBI Gene 389792 |  KEGG hsa:389792
Gene Symbol IER5L
Protein Name immediate early response 5 like
Synonyms bA247A12.2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056660 IRAK141K20 pCMV-SPORT6 BC064028 NM_203434

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113616 M01C084A16 pDONR221 IMS05-F08 BC064028 NM_203434  
HGE113664 M01C084C16 pDONR221 IMS05-F08 BC064028 NM_203434  
HGE113712 M01C084E16 pDONR221 IMS05-F08 BC064028 NM_203434  
HGE113760 M01C084G16 pDONR221 IMS05-F08 BC064028 NM_203434  
HGE113808 M01C084I16 pDONR221 IMS05-F08 BC064028 NM_203434  
HGE113856 M01C084K16 pDONR221 IMS05-F08 BC064028 NM_203434  
HGE113904 M01C084M16 pDONR221 IMS05-F08 BC064028 NM_203434  
HGE113952 M01C084O16 pDONR221 IMS05-F08 BC064028 NM_203434  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062801 ARe57A01 pKA1U5 NM_203434.2  
GATTGCTTTGGCGCCGTCTGGGGAGCGCGAGCCCGCGGGTGGCGCGCGGCGCATGGTGGC
HKR172546 ARi31G02 pGCAP10 NM_203434.2  
TGATTGCTTTGGCGCCGTCTGGGGAGCGCGAGCCCGCGGGTGGCGCGCGGCGCATGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl