Prev. | 

RIKEN DNA Bank Human Resource - GLIDR

Gene ID NCBI Gene 389741 |  KEGG hsa:389741
Gene Symbol GLIDR
Protein Name glioblastoma down-regulated RNA
Synonyms LINC01172|TCONS_00015562
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001860 IRAK004K20 pCMV-SPORT6 BC000869 NM_203448 Full
HGX010669 IRAK026L05 pCMV-SPORT6 BC027338 NM_203448
HGX016824 IRAK042A24 pCMV-SPORT6 BC019880 NM_203448
HGX033608 IRAK084A08 pCMV-SPORT6 BC040170 NM_203448 Partial/var
HGX066501 IRAK166E05 pCMV-SPORT6 BC081570 NM_203448 Partial
HGY084030 IRAL010B06 pOTB7 BC015151 NM_203448

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180833 ARi52B09 pGCAP10 NR_015363.1  
GCCTTGCTGCAATGTAATTATATTTAATTACAAGTGTGCCCCTGGTAGTCTTTAACTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl