Prev. |  KEGG KO K20710 > 

RIKEN DNA Bank Human Resource - ARHGEF37

Gene ID NCBI Gene 389337 |  KEGG hsa:389337
Gene Symbol ARHGEF37
Protein Name Rho guanine nucleotide exchange factor 37
Synonyms -
Ortholog resource in our bank

  ARHGEF37

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE117231 M01C093B07 pDONR221 IMS10-C04 AK123597 ENST00000333677  
HGE117279 M01C093D07 pDONR221 IMS10-C04 AK123597 ENST00000333677  
HGE117327 M01C093F07 pDONR221 IMS10-C04 AK123597 ENST00000333677  
HGE117375 M01C093H07 pDONR221 IMS10-C04 AK123597 ENST00000333677  
HGE117423 M01C093J07 pDONR221 IMS10-C04 AK123597 ENST00000333677  
HGE117471 M01C093L07 pDONR221 IMS10-C04 AK123597 ENST00000333677  
HGE117519 M01C093N07 pDONR221 IMS10-C04 AK123597 ENST00000333677  
HGE117567 M01C093P07 pDONR221 IMS10-C04 AK123597 ENST00000333677  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042950 ARe07G06 pKA1U5 NM_001001669.2  
GGAGCCGGCCGGGGCTGACTCCGGGAGCAGCGCACTTAAAACAACCTGGCTCCAGAAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl