Prev. | 

RIKEN DNA Bank Human Resource - SMIM20

Gene ID NCBI Gene 389203 |  KEGG hsa:389203
Gene Symbol SMIM20
Protein Name small integral membrane protein 20
Synonyms C4orf52|MITRAC7|PNX
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025628 IRAK064B04 pCMV-SPORT6 BC032431 XM_371691 Partial/var
HGX033621 IRAK084A21 pCMV-SPORT6 BC040154 XM_371691
HGX042801 IRAK107A01 pCMV-SPORT6 BC046171 XM_371691 Partial/var
HGY088550 IRAL021G06 pDNR-LIB BC006003 XM_371691 Partial/var
HGY100698 IRAL051M10 pDNR-LIB BC062747 XM_371691 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170411 ARi26A11 pGCAP10 NM_001145432.1  
GGTCGGTAACCTGGTTTCCGAGAGTGCCGGGCGGTCGGCGGGTCAGGGCAGCCCGGGGCC
HKR342079 RBb55D07 pGCAP1 NM_001145432.1  
GCTCTTCCGAGCGGGGTCACGGCCCGGCCGTCGGTAACCTGGTTTCCGAGAGTGCCGGGC
HKR442232 RBdS105J16 pGCAP10 NM_001145432.1  
GCCTCAAGGCCCGGAAGCGAAAGCCTCTCCACCTCTTCCGAGCGGGGTCACGGCCCGGCC
HKR470966 RBdS177G22 pGCAP10 NM_001145432.1  
GACCTCTTCCGAGCGGGGTCACGGCCCGGCCGTCGGTAACCTGGTTTCCGAGAGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl