Prev. | 

RIKEN DNA Bank Human Resource - DPP10-AS1

Gene ID NCBI Gene 389023 |  KEGG hsa:389023
Gene Symbol DPP10-AS1
Protein Name DPP10 antisense RNA 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029465 IRAK073L01 pBluescriptR BC032913
HGY042490 IRAK106D18 pBluescript BC048425

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR328083 RBb20D11 pKA1U5 NR_036580.1  
GGTGCGAAGCCCTGGGTGGCTCCAGCTCCGCCACTGCGCGCGCTCCAGCGCCCCAGAAGG
HKR334575 RBb36H07 pGCAP1 NR_036580.1  
GGTGCGAAGCCCTGGGTGGCTCCAGCTCCGCCACTGCGCGCGCTCCAGCGCCCCAGAAGG
HKR369770 RBd24H02 pGCAP10 NR_036580.1  
GGCCACTGCGCGCGCTCCAGCGCCCCAGAAGGCAGGGGGCAGCCCGGGGACCGGGGTCCC
HKR385236 RBd63B12 pGCAP10 NR_036580.1  
GTCTCCTACCAGCTGCTTGGGTCACGTCGGTGGAACTCCTAAAGGGATGCCTTCAAAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl