Prev. | 

RIKEN DNA Bank Human Resource - LOC388813

Gene ID NCBI Gene 388813 |  KEGG hsa:388813
Gene Symbol LOC388813
Protein Name uncharacterized protein ENSP00000383407-like
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR382502 RBd56E06 pGCAP10 XM_373925.6  
GATATTTTTCAAAGCAGGGCAACAAGAGAGTGAAGCTGGTCANNATNNATCTTTTCTGCA
HKR402932 RBdS007F12 pGCAP10 XM_373925.6  
GGCTGTGAAGGCAAGAGAGAGCTACAAGAGGCAATCATATTTTTCAAAGCAGGGCAACAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl