Prev. | 

RIKEN DNA Bank Human Resource - SNHG17

Gene ID NCBI Gene 388796 |  KEGG hsa:388796
Gene Symbol SNHG17
Protein Name small nucleolar RNA host gene 17
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037213 IRAK093A13 pCMV-SPORT6 BC052370 XM_943257 Partial
HGY095893 IRAL039M05 pOTB7 BC032119 XM_943257 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072526 ARe81F06 pKA1U5 NR_015366.3  
AGAGTCCTTCGCCGTCCCTCGCCGTCCTTCGCCATCGCACGCCACCGCACCCCATCTCTC
HKR222347 ARiS055O11 pGCAP10 NR_015366.3  
GGTATTTCCGCCGGCGCGAAACNAGCGTAGCTTCCTTGTCGTGTGGCCTCAGTCCTTCGC
HKR394873 RBd87D01 pGCAP10 NR_015366.3  
GTGTATTTCCGCCGGCGCGAAACGAGCGTAGCTTCCTTGTCGTGTGGCCTCAGTCCTTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl