Prev. |  KEGG KO K18179 > 

RIKEN DNA Bank Human Resource - COA6

Gene ID NCBI Gene 388753 |  KEGG hsa:388753
Gene Symbol COA6
Protein Name cytochrome c oxidase assembly factor 6
Synonyms C1orf31|CEMCOX4
Ortholog resource in our bank

  COA6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024814 IRAK062A14 pCMV-SPORT6 BC025793 NM_001012985 Partial
HGX031580 IRAK078P20 pCMV-SPORT6 BC035925 NM_001012985 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR387298 RBd68E02 pGCAP10 NM_001012985.1  
GACGCTTCTAGAGCTTGAGCCAGCGGGGCGACCCTGCAGTGGCAGGACTCGGCACCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl