Prev. | 

RIKEN DNA Bank Human Resource - FAM69A

Gene ID NCBI Gene 388650 |  KEGG hsa:388650
Gene Symbol FAM69A
Protein Name family with sequence similarity 69 member A
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103021 IRAL057J05 pDNR-LIB BC070342 NM_001006605 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068945 ARe72G01 pKA1U5 NM_001006605.3  
GGCCAGCGCTCGGGTCCGCCTCTGACTGCAGCGCGGNGGGGCGATGTGTGATTACCATGG
HKR165699 ARi14E03 pGCAP10 NM_001006605.3  
GGCTCGGGTCCGCCTCTGACTGCAGCGCGGCGGGGCGATGTGTGATTACCATGGCGAGGA
HKR209433 ARiS023J17 pGCAP10 NM_001006605.3  
GGCTCGGGTCCGCCTCTGACTGCAGCGCGGCGGGGCGATGTGTGATTACCATGGCGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl