Prev. | 

RIKEN DNA Bank Human Resource - TMEM220

Gene ID NCBI Gene 388335 |  KEGG hsa:388335
Gene Symbol TMEM220
Protein Name transmembrane protein 220
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182905 ARi57E09 pGCAP10 NM_001004313.1  
AGGACGGCGCCGCCTACACCCCGCGGCGTTCGGGGCGGGCTGAATGGGTCGCTGAGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl