Prev. | 

RIKEN DNA Bank Human Resource - GOLGA2P7

Gene ID NCBI Gene 388152 |  KEGG hsa:388152
Gene Symbol GOLGA2P7
Protein Name golgin A2 pseudogene 7
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069617 IRAK174A17 pCMV-SPORT6 BC072390

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR334826 RBb37B02 pGCAP1 XR_040915.1  
AGACGTTACTGCCCTCTTGCGTGCCCCGGCCACCCCCGGGCGGCTTGTAGCCGGTGCGCG
HKR361332 RBd03F12 pGCAP10 XR_040915.1  
GGTGCAGGGCCAGCGCGGAGCCCGAGCAGCCGCGGTGAAGCGCCTGTGCTCTGCCGAGAC
HKR363203 RBd08A03 pGCAP10 XR_040915.1  
GCTCTTGCGTGCCCCGGCCACCCCCGGGCGGCTTGTAGCCGGTGCGCGGGGTGGCTGGGG
HKR397252 RBd93C04 pGCAP10 XR_040915.1  
GACGTGCAGAGCTGTCGCGGAGCCGGAACAGCAGCGGTGAAGCCCCTCGGCTCGGCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl