Prev. |  KEGG KO K11428 > 

RIKEN DNA Bank Human Resource - KMT5A

Gene ID NCBI Gene 387893 |  KEGG hsa:387893
Gene Symbol KMT5A
Protein Name lysine methyltransferase 5A
Synonyms PR-Set7|SET07|SET8|SETD8
Ortholog resources KEGG ortholog (KEGG orthology K11428) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036257 IRAK090K17 pBluescript BC050346 NM_020382 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE086011 M01C015A11 pDONR221 FLJ05-A06 BC050346 NM_020382  
HGE086059 M01C015C11 pDONR221 FLJ05-A06 BC050346 NM_020382  
HGE086107 M01C015E11 pDONR221 FLJ05-A06 BC050346 NM_020382  
HGE086155 M01C015G11 pDONR221 FLJ05-A06 BC050346 NM_020382  
HGE086203 M01C015I11 pDONR221 FLJ05-A06 BC050346 NM_020382  
HGE086251 M01C015K11 pDONR221 FLJ05-A06 BC050346 NM_020382  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037713 W01A094E17 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE037715 W01A094E19 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE037717 W01A094E21 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE037719 W01A094E23 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE037745 W01A094G01 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE037749 W01A094G05 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE037751 W01A094G07 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE037753 W01A094G09 pENTR-TOPO IRAK090K17 BC050346 NM_020382  
HGE046496 W01A116D24 pENTR-TOPO IRAK090K17 BC050346 NM_020382  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR388808 RBd72A08 pGCAP10 NM_020382.3  
GGAGCGGGCGGGAGGGCTGCGGAGGACGCGCCGCCTGCGCCTCCTTCCCTTCGTGCCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl