Prev. |  KEGG KO K18462 > 

RIKEN DNA Bank Human Resource - WASHC2A

Gene ID NCBI Gene 387680 |  KEGG hsa:387680
Gene Symbol WASHC2A
Protein Name WASH complex subunit 2A
Synonyms FAM21A|FAM21B|bA56A21.1|bA98I6.1
Featured content Endocytosis (human)
Ortholog resource in our bank

  WASHC2A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053655 IRAK134C07 pCMV-SPORT6 BC065500 NM_001005751 Partial
HGX055966 IRAK139P06 pCMV-SPORT6 BC064639 NM_001005751 Partial/var
HGX066422 IRAK166A22 pCMV-SPORT6 BC075815 NM_001005751 Partial/var
HGY103835 IRAL059J19 pOTB7 BC082258 NM_001005751 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE108039 M01C070B15 pDONR221 06_09-G08 AK001686 ENST00000314664  
HGE108087 M01C070D15 pDONR221 06_09-G08 AK001686 ENST00000314664  
HGE108135 M01C070F15 pDONR221 06_09-G08 AK001686 ENST00000314664  
HGE108183 M01C070H15 pDONR221 06_09-G08 AK001686 ENST00000314664  
HGE108231 M01C070J15 pDONR221 06_09-G08 AK001686 ENST00000314664  
HGE108279 M01C070L15 pDONR221 06_09-G08 AK001686 ENST00000314664  
HGE108327 M01C070N15 pDONR221 06_09-G08 AK001686 ENST00000314664  
HGE108375 M01C070P15 pDONR221 06_09-G08 AK001686 ENST00000314664  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR186903 ARi67E07 pGCAP10 NM_001005751.1  
GGGCTGGGGCTAGGCTTCCGGGGCTCTGCGGTCCTCGGCCTGTGCTGGCAGCCTCGGAGC
HKR188480 ARi71D08 pGCAP10 NM_001005751.1  
GAGTCCTCGGCGTGTGCTGGCAGCTTCGGAGCCCACCGAGCCGGGCGGCTAGGATGATGA
HKR375371 RBd38H03 pGCAP10 NM_001005751.1  
GGGTCACGCCCCGGGCAGCTTGGCTGGGGCTAGGCTTCCGGGGCTCTGCGGTCCTCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl