Prev. |  KEGG KO K08437 > 

RIKEN DNA Bank Human Resource - GPR153

Gene ID NCBI Gene 387509 |  KEGG hsa:387509
Gene Symbol GPR153
Protein Name G protein-coupled receptor 153
Synonyms PGR1
Ortholog resource in our bank

  GPR153

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR430046 RBdS075B22 pGCAP10 NM_207370.1 Full done
GGCAGCAGCGGAGCGGCGGGAGCTGAGCGAAGCGCGGCGGCGGCGGCGGCGCCTAGGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl