Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GPR153

Gene ID (NCBI) 387509
Gene Symbol GPR153
Protein Name G protein-coupled receptor 153
Synonyms PGR1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08437)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR430046 RBdS075B22 pGCAP10 NM_207370.1  
GGCAGCAGCGGAGCGGCGGGAGCTGAGCGAAGCGCGGCGGCGGCGGCGGCGCCTAGGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl