Prev. | 

RIKEN DNA Bank Human Resource - CENPW

Gene ID NCBI Gene 387103 |  KEGG hsa:387103
Gene Symbol CENPW
Protein Name centromere protein W
Synonyms C6orf173|CENP-W|CUG2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035221 IRAK088A21 pCMV-SPORT6 BC039556 NM_001012507 Full
HGX042831 IRAK107B07 pCMV-SPORT6 BC046178 NM_001012507 Full
HGY094593 IRAL036I01 pDNR-LIB BC017928 NM_001012507 Full
HGY100708 IRAL051M20 pDNR-LIB BC062798 NM_001012507 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050402 ARe26A02 pKA1U5 NM_001012507.2  
ATCCTGGGTTTTTCTGCCTGAAGAAGCGTCATACGGACCGGATTGTTTTCGCTGGCCCAG
HKR219727 ARiS049F07 pGCAP10 NM_001012507.2  
GGAAGAAGCGTCATACGGACCGGATTGTTTTCGCTGGCCCAGTGTCCCCGGAGCTTGTGT
HKR388030 RBd70B06 pGCAP10 NM_001012507.2  
GACTGAGCGCCGGGCGCGTTCCGTTGGCGGCGGATTCGAACGTTCGGACTGAGGTTTTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl