Prev. |  KEGG KO K06254 > 

RIKEN DNA Bank Human Resource - AGRN

Gene ID NCBI Gene 375790 |  KEGG hsa:375790
Gene Symbol AGRN
Protein Name agrin
Synonyms AGRIN|CMS8|CMSPPD
Ortholog resource in our bank

  AGRN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008303 IRAK020M15 pCMV-SPORT6 BC034009 NM_198576 Partial
HGX053647 IRAK134B23 pCMV-SPORT6 BC063620 NM_198576 Partial
HGX069619 IRAK174A19 pCMV-SPORT6 BC084578 NM_198576 Partial
HGY084455 IRAL011C07 pOTB7 BC004220 NM_198576 Partial
HGY089497 IRAL023M09 pOTB7 BC007649 NM_198576 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040828 ARe02B04 pKA1U5 NM_198576.4 full cds  
GCCCGTCCCCGGCGCGGCCCGCGCGCTCCTCCGCCGCCTCTCGCCTGCGCCATGGCCGGC
HKR234322 ARiS085N10 pGCAP10 NM_198576.2  
GAGTCCCGTCCCCGGCGCGGCCCGCGCGCTCCTCCGCCGCCTCTCGCCTGCGCCATGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl