Prev. | 

RIKEN DNA Bank Human Resource - ZNF710

Gene ID NCBI Gene 374655 |  KEGG hsa:374655
Gene Symbol ZNF710
Protein Name zinc finger protein 710
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR398503 RBd96E07 pGCAP10 NM_198526.4 done
GAGGAGCATTGCGGCGGGCGCGCGTGGAGGCGGGCGGCGGGCGCACAGCAGCCGCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv

2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl