Prev. | 

RIKEN DNA Bank Human Resource - TMEM179B

Gene ID NCBI Gene 374395 |  KEGG hsa:374395
Gene Symbol TMEM179B
Protein Name transmembrane protein 179B
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099146 IRAL047O10 pOTB7 BC051355 NM_199337

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092844 M01C032B20 pDONR221 MGC05-H10 BC051355 NM_199337  
HGE092892 M01C032D20 pDONR221 MGC05-H10 BC051355 NM_199337  
HGE092940 M01C032F20 pDONR221 MGC05-H10 BC051355 NM_199337  
HGE092988 M01C032H20 pDONR221 MGC05-H10 BC051355 NM_199337  
HGE093036 M01C032J20 pDONR221 MGC05-H10 BC051355 NM_199337  
HGE093084 M01C032L20 pDONR221 MGC05-H10 BC051355 NM_199337  
HGE093132 M01C032N20 pDONR221 MGC05-H10 BC051355 NM_199337  
HGE093180 M01C032P20 pDONR221 MGC05-H10 BC051355 NM_199337  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171728 ARi29F08 pGCAP10 NM_199337.2  
GCTGGTGGTCAGGGCGCCATGGCGCTGTCCTGGCTGCAGCGCGTCGAGCTTGCGCTCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl