Prev. |  KEGG KO K13299 > 

RIKEN DNA Bank Human Resource - GSTK1

Gene ID NCBI Gene 373156 |  KEGG hsa:373156
Gene Symbol GSTK1
Protein Name glutathione S-transferase kappa 1
Synonyms GST|GST 13-13|GST13|GST13-13|GSTK1-1|hGSTK1
Ortholog resource in our bank

  GSTK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001956 IRAK004O20 pCMV-SPORT6 BC001231 NM_015917 Full
HGX044203 IRAK110I11 pCMV-SPORT6 BC050715 NM_015917 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052506 ARe31E10 pKA1U5 NM_015917.1  
GCTGCTGCCACTGCCTCTTCCGGAGCCTGCAGCATGGGGCCCCTGCCGCGCACCGTGGAG
HKR170460 ARi26C12 pGCAP10 NM_015917.1  
GGGGAAAAGGAGCTCCTGCTGCCACTGCTCTTCCGGAGCCTGCAGCATGGGGCCCCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl