Prev. | 

RIKEN DNA Bank Human Resource - ANKRD37

Gene ID NCBI Gene 353322 |  KEGG hsa:353322
Gene Symbol ANKRD37
Protein Name ankyrin repeat domain 37
Synonyms Lrp2bp
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078011 ARe95A11 pKA1U5 NM_181726.2  
ATCCTGGGGACAGCGGCTTCACCAGCCCCGCGGGTCCGAATCGCACGCGGCCGGGTCCGC
HKR163308 ARi08E12 pGCAP10 NM_181726.2  
GGCATTCTTACCTGTCGGGGTGCGGCGAGTGTCTCACCTCTCTGCACTTCCAAGGACTCT
HKR365773 RBd14H05 pGCAP10 NM_181726.2  
GGCTTCACCAGCCCCGCGGGTCCGAATCGCACGCGGCCGGGTCCGCTCTCCCGGGAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl