Prev. |  KEGG KO K22733 > 

RIKEN DNA Bank Human Resource - NIPAL4

Gene ID NCBI Gene 348938 |  KEGG hsa:348938
Gene Symbol NIPAL4
Protein Name NIPA like domain containing 4
Synonyms ARCI6|ICHTHYIN|ICHYN
Ortholog resource in our bank

  NIPAL4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054082 ARe35D10 pKA1U5 NM_001099287.1  
GGCGCGCGAGCCACGCGGGGGACAAGTCGCGGCCACNTGCTCCGGAGCTGGGGAGCCCGG
HKR184126 ARi60F06 pGCAP10 NM_001099287.1  
GGCGCGCGCGAGCCACGCGGGGGACAAGTCGCGGCCACCTGCTCCGGAGCTGGGGAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl