Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NIPAL4

Gene ID (NCBI) 348938
Gene Symbol NIPAL4
Protein Name NIPA like domain containing 4
Synonyms ARCI6|ICHTHYIN|ICHYN
Databases KEGG hsa:348938 |  NCBI Gene 348938


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054082 ARe35D10 pKA1U5 NM_001099287.1  
GGCGCGCGAGCCACGCGGGGGACAAGTCGCGGCCACNTGCTCCGGAGCTGGGGAGCCCGG
HKR184126 ARi60F06 pGCAP10 NM_001099287.1  
GGCGCGCGCGAGCCACGCGGGGGACAAGTCGCGGCCACCTGCTCCGGAGCTGGGGAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl