Prev. | 

RIKEN DNA Bank Human Resource - MCRIP1

Gene ID NCBI Gene 348262 |  KEGG hsa:348262
Gene Symbol MCRIP1
Protein Name MAPK regulated corepressor interacting protein 1
Synonyms FAM195B|GRAN2|MCRIP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053949 IRAK134O13 pCMV-SPORT6 BC063557 NM_207368 Partial/var
HGY089486 IRAL023L22 pOTB7 BC017108 NM_207368 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE118005 M01C095A05 pDONR221 IMS11-A03 AK125584 NM_207368  
HGE118053 M01C095C05 pDONR221 IMS11-A03 AK125584 NM_207368  
HGE118101 M01C095E05 pDONR221 IMS11-A03 AK125584 NM_207368  
HGE118149 M01C095G05 pDONR221 IMS11-A03 AK125584 NM_207368  
HGE118197 M01C095I05 pDONR221 IMS11-A03 AK125584 NM_207368  
HGE118245 M01C095K05 pDONR221 IMS11-A03 AK125584 NM_207368  
HGE118293 M01C095M05 pDONR221 IMS11-A03 AK125584 NM_207368  
HGE118341 M01C095O05 pDONR221 IMS11-A03 AK125584 NM_207368  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069210 ARe73A10 pKA1U5 NM_207368.1  
GCCAGCTGGAAGAGGCGGTGGCGGCGGGTCGGNNCNAGAGGCTGAGGGGATCTGGCGGTG
HKR075377 ARe88H09 pKA1U5 NM_207368.1  
GAGAGGCGGTGGCGGCGGGTCGGGGCGAGAGGCTGAGGGGATCTGGCGGTGGAGCGCTAG
HKR209207 ARiS023A07 pGCAP10 NM_207368.1  
GGGAAGAGGCGGTGGCGGCGGGTCGGGGCGAGAGGCTGAGGGGATCTGGCGGTGGAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl